Ten weird things you can buy online (and why you would)

It’s April Cools! It’s like April Fools, except instead of cringe comedy you make genuine content that’s different from your normal stuff.¹ For example, last year I talked about owning a microscope. This year I debated doing another hobby but settled on a much dumber topic.

Have you ever seen those lists of weird things you can buy online? It’s always just novelties and gag gifts. I’m much more interested in the weird things with a legitimate use case. Nicolas Cage throw pillow? Just weird. Three pounds of live bees? Weird and cool.

Back in 2020, stuck inside and bored out of my mind, I decided to assemble my own Weird Thing list. My (loose) criteria were:

1. Not a one-off. It’s either something a merchant is selling on an ongoing basis or something with an active marketplace of buyers and sellers.
2. There’s an actual legitimate use. No gag gifts or collectors items.
3. There’s an actual price. It’s not “call for a quote”. If I have to call for a quote then I can’t just buy it on a whim.

After I got a bunch I started a gimmick Twitter account to share them, then within two weeks discovered I hated running a gimmick Twitter account and shut it down. But I do like blogging, so here’s 10 weird things you can buy online and why you might want to.

Three Yards of Books

Merchant or Market: Merchant

Where: Books by the Foot

What: Old books, $60/foot. Fiction books, $25/foot. The Joy of Cooking, $50/foot.

Why: Two main clientele: clients who want filled bookshelves as part of their decor and filmmakers who need set dressing. These use cases are reflected in how they organize offerings: you can buy a specific genre, but also buy a specific binding style or color. My favorite detail is a bit of pricing: A foot of modern books are $10. Modern books with all the racy stuff removed is $20.

Human Milk

Merchant or Market: Market

Where: BreastfeedingMomsUnite

What: Breast milk, usually around $1-2/oz

Why: From the site:

This breast milk market will be of help to women who need to breastfeed their babies but cannot produce enough breast milk. Hence mothers who are willing to donate can help others who are having reduced supply of breast milk.

The government majorly regulates the trade of body fluids and organs (tissues, semen, blood, livers, and kidneys…), but not breast milk, thus donating, buying or selling breast milk is 100% legal.

(Yes there are creeps on the site too, but their ads are taken down p. quickly)

I really like how this is the perfect example of how marketplaces develop. Some women overproduce milk, some underproduce it, there’s an inefficiency in allocation, therefore market!

A life-size animatronic whale shark

Merchant or Market: Merchant

Where: My Dinosaurs Culture and Arts Co

What: Life-size animal animatronics and skeletons. Also for some reason, giant teacups and Statues of Liberty. Price varies per item but it’s roughly mid thousands to low ten-thousands.

Why: Theme parks and/or museums, depending on the product. There are more natural history museums in California than there are T-Rex fossils in the whole world. They claim all their skeletons are anatomically accurate.

If you’re in the market for nightmares, they also sell animatronic people.

Private Islands

Merchant or Market: Market

Where: Private Islands inc.

What: Private islands. Surprisingly enough, there are plenty of islands that sell for under half a million dollars. Unsurprisingly, there are also islands that sell for a hundred million. Only one other product on this list comes close to those prices.

Why: I guess it’s like owning real estate, except the real estate is an entire island? Billionaires use the internet too ¯\_(ツ)_/¯

I knew that some people owned private islands, but I didn’t expect there to be an online marketplace. Turns out it’s been around since 1999! They have a magazine and everything.

Uranium

Merchant or Market: Merchant

Where: United Nuclear

What: Radioactive Isotopes for $100 each. You pick the isotope.

Why: Calibrating scientific equipment and powering cloud chambers. The isotopes are small enough to be safe.

I looked to see if you could buy (tiny amounts of) weapons-grade uranium but unsurprisingly nobody’s offering that. I did find this cool place which does radiocarbon dating for $500 a sample.

Keeping on the topic of scientific research:

Chlamydia

Merchant or Market: Merchant

Where: American Type Culture Collection

What: Clamydia for $1200. You can also buy COVID-19, tuberculosis, and drug-resistant tuberculosis. And, if you really want, you can buy a packet of brewer’s yeast for $431.

Why: Biomedical research. Unsurprisingly, you need a license to purchase anything. Still pretty neat that labs who need bioweapons can just go to a website and click “checkout”.

My favorite little bit is this section of the yeast quality control specifications:

26S ribosomal RNA gene, partial sequence ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGCATT

There’s just something really funny about the verification being “sequence it and make sure it’s got these 600 characters in a row.”

Live Bees

Where: Mountain Sweet Honey Company

What: Three pounds of bees for $144.

Why: Apiaries! There are over 100,000 beekeepers in the US and they all had to get their starter colonies from somewhere. It’s either buy the bees or buy a pint of bee pheromones and attract them yourself.

Live bees are one of the few animals explicitly listed as shippable, under USPS postal code 526 Mailable Live Animals along with day-old chicks and live scorpions.² But in general you can ship “small, harmless, cold-blooded animals”,³ so there’s a lot of business in selling insects. In particular, you can buy 1500 ladybugs for organic pest control and 100 butterflies for wedding services.

For the record, the USPS explicitly considers all nonvenomous insects as “harmless”, which means you can ship

Bedbugs

Merchant or Market: Seller

Where: https://www.cheapbedbugs.com/product-page/6-month-subscription

What: 600 bedbugs, $750.

Why: The fastest way to check a lot of places (say, a hotel) for bedbugs is with bedbug-sniffing dogs, and you’re trying to train bedbug-sniffing dogs, you need live samples of bedbugs to use for training. Hence, a live bedbug supplier.

Thankfully, the site is run by one guy and he wants a copy of your business license before selling you anything, so no buying bedbugs to torment your enemies. I dunno why but the tone of his FAQ makes him seem more trustworthy.

Rollercoasters

Merchant or Market: Both

Where: usedrides.com, amusement-rides, amusementsupplyco. Lots more sellers but they’re all “contact for a quote” places.

What: Anything you’d need for an amusement park. Food carts, kiddie rides, carousels, even entire rollercoasters. Prices vary.

Why: It makes sense when you think about it. There are over 400 permanent amusement parks in the US alone, not counting the thousands of county and state fairs. Most amusement parks have a static pool of attendees, and people crave novelty. A well-maintained carnival ride can last for decades. There’s plenty supply from parks trying to exchange rides and plenty demand from places trying to buy them, which means marketplaces.

I’m a little more surprised at how many sites I found. On some investigation, it seems this is driven by logistical concerns. Even small rides weigh 10+ tons and you’ll want to minimize transportation fees as much as possible. Different regions have different marketplaces.

Oil Tankers

Merchant or Market: Market

Where: Horizon Ship Brokers

What: Ships. Ships of all kinds. Cruise ships. Research vessels. Oil tankers. Anywhere from under a million to over 30 million.

Why: It’s insane to think that there’d be a secondhand market for eight-hundred foot oil tankers. This sent me down the UN Maritime Transport Review rabbit-hole, where I learned that in 2021 shipyards built the tonnage-equivalent of 1200 Aframaxes (pdf. 43). Nothing else made me realize just how unimaginably vast world trade is and just how much work goes into keeping the international supply chains running.

Honorable mentions

Some things that I are either interesting but not that surprising, or where I just don’t have much to say about them.

• I used to buy 25 pound chocolate sacks for small-scale chocolatiering.
• T-shirt printers: It’s a printer that takes t-shirts instead of paper! Also it costs $19,000
• Pig fetuses and owl poop pellets: science classrooms
• Can’t afford an oil tanker? Start small with buying a small business or two.
• Priceless cultural artifacts like cuneiform tablets do in fact have a price, and it’s usually in the mid hundreds to low thousands. The site claims they have provenance proof that all their wares come from before the Dealing in Cultural Objects Act 2003 cutoff, but I don’t know how trustyworthy they are.
• Several friends asked that I put in heavy water and I value my friendships more than my integrity.

Thanks to Predrag Gruevski and Jeremy Kun for feedback and also suggesting things to look into. If you enjoyed this, you can head over to my newsletter for a second unrelated April Cools, or the April Cools website for all the other pieces this year!